AICS-0083
Protein
mRNA-decapping enzyme 1A (DCP1A)
Gene Symbol
DCP1A
Gene Name
decapping mRNA 1A
Structure
processing bodies (P-bodies)

Obtain AICS-0083

Obtain Donor Plasmid

AICS-0083

DCP1A in WTC-mEGFP (bi-allelic tag)
Cell line media

hiPS cells expressing mEGFP-tagged mRNA-decapping enzyme 1A (DCP1A) control cells (left panel) and cells in the presence of 62.5 µM sodium arsenite for 60 minutes (right panel). Main panel images (scalebar, 20 um) show the change in distribution of puncta at the colony level with oxidative stress. Insets (scalebar, 5 um) show structural detail of puncta in center cells in each condition (different cells imaged at higher resolution). Images are maximum intensity projections spanning the whole cell volume (main panel) or 1.5 µm around the middle z-section of the cells (insets). Cells were imaged live in 3D on a spinning-disk confocal microscope.

thumbnail image
thumbnail image
thumbnail image
Video thumbnail
Video thumbnail
Video thumbnail
Video thumbnail
NCBI Isoforms:
crRNA Target Site:GGCTCTGGGATTCAAGATGG
Linker: SRA
Cas9:Wildtype spCas9
mEGFP Insert
mEGFP Insert
Top: DCP1A locus showing 3 DCP1A isoforms; Bottom: Zoom in on mEGFP insertion site at DCP1A N-Terminus.